|
Marker DXS6803
Primer
| PrimerF: |
5' - |
GAAATGTGCTTTGACAGGAA |
- 3' |

| PrimerR: |
5' - |
CAAAAAGGGACATATGCTACTT |
- 3' |
Typical structure| 10 | 109 | PF-N19-(TCTA)10-N8-PR | | 11 | 113 | PF-N19-(TCTA)11-N8-PR | | 12 | 117 | PF-N19-(TCTA)12-N8-PR | | 12.3 | 120 | PF-N19-(TCTA)11-(TCA)-(TCTA)1-N8-PR | | 13 | 121 | PF-N19-(TCTA)13-N8-PR | | 13.3 | 124 | PF-N19-(TCTA)12-(TCA)-(TCTA)1-N8-PR | | 14 | 125 | PF-N19-(TCTA)14-N8-PR | | 14.3 | 128 | PF-N19-(TCTA)13-(TCA)-(TCTA)1-N8-PR |

| Comment: |
PF: sequence of primer PF (20 bp), PR: complementary sequence of primer PR (22 bp), N19: AAACAATATACACAGAATG, N8: TCGAGATA,. |
| K562 (BRL) | 9 | | K562 (Promega) | 9 | | NA3657 | 11 | | NA9947A | 11, 11 | | NA9948 | 12 |
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.| 1 | China (Wuhan) | Huang D... | 0.6724 | 0.7056 | 0.4933 | 0.6724 | 0.6724 | 0.5298 | 0.8801 | 0.7056 | | 2 | Germany (Western Saxonia) | Edelman... | 0.7727 | 0.8013 | 0.6090 | 0.7727 | 0.7727 | 0.6476 | 0.9318 | 0.8013 | | 3 | Germany (Western Saxonia) | Edelman... | 0.7880 | 0.8136 | 0.6322 | 0.7880 | 0.7880 | 0.6674 | 0.9397 | 0.8136 | | 4 | Germany (Western Saxonia) | Edelman... | 0.7849 | 0.8111 | 0.6274 | 0.7850 | 0.7849 | 0.6632 | 0.9381 | 0.8111 |
| 1 |
China (Wuhan) |
Asian (Chinese Han) |
Huang D... |
292 females |
|
0.0130 |
0.1940 |
0.1030 |
0.1080 |
0.4770 |
|
0.0780 |
|
0.0270 |
| 2 |
Germany (Western Saxonia) |
Caucasian (European) |
Edelman... |
199 males |
|
0.0251 |
0.2613 |
|
0.2613 |
0.1407 |
0.1759 |
0.1005 |
0.0201 |
0.0151 |
| 3 |
Germany (Western Saxonia) |
Caucasian (European) |
Edelman... |
308 females |
0.0032 |
0.0390 |
0.2240 |
|
0.2630 |
0.1201 |
0.1997 |
0.0990 |
0.0325 |
0.0195 |
| 4 |
Germany (Western Saxonia) |
Caucasian (European) |
Edelman... |
507 |
0.0025 |
0.0356 |
0.2331 |
|
0.2626 |
0.1252 |
0.1939 |
0.0994 |
0.0294 |
0.0184 |
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
References
- Cirigliano V, Lewin P, Szpiro-Tapies S, Fuster C, Adinolfi M (2001) Assessment of new markers for t...
- Fodor F, Kamory E, Csokay B, Kopa Z, Kiss A, Lantos I, Tisza T (2007) Rapid detection of sex chromo...
- Huang DX, Yang QG, Yu CY, Yang RZ (2003) Development of the X-linked tetrameric microsatellite mark...
- Jia Y, Zhou B, Liang WB, Lv ML, Zhang L (2004) Two X-chromosome STR loci DXS6803 and XS6793 frequen...
- Liu QL, Lv DJ, Wu XL, Sun HY, Wu XY, Lu HL (2008) Development of a five ChX STRs loci typing system...
- Plaseski T, Noveski P, Trivodalieva S, Efremov GD, Plaseska-Karanfilska D (2008) Quantitative Fluor...
- Son JY, Lee YS, Choung CM, Lee SD (2002) Polymorphism of nine X chromosomal STR loci in Koreans. In...
- Szibor R, Edelmann J, Hering S, Plate I, Wittig H, Roewer L, Wiegand P, Cali F, Romano V, Michael M...
- Zarrabeitia MT, Alonso A, Martin J, Gonzalez-Gay MA, Martin-Escudero JC, de Pancorbo MM, Sanz P, Ru...
- Edelmann J, Lessig R, Hering S, Horn LC (2004) Loss of heterozygosity and microsatellite instabilit...
|
 |

NewsLast updates:
• DXS9908 (DXS7127)• DXS6795• DXS6803• DXS10103• DXS8378
StatisticsPopulations: 44
Marker: 55
Allele frequencies: 2855 
|
 |