|
Marker DXS9908 (DXS7127)
| Create date: |
Jun 25, 2009 12:18:15 PM |
| Last update: |
Jan 27, 2010 10:40:01 AM |
 |
 |
| Cytogenetic localisation: |
q 27.30 |
| Physical localisation NCBI 36: |
142.769 |
| Genetic localisation deCODE: |
156.55 |
| Rutgers Map v.2: |
169.87 |
 |
 |
| Reference: |
Edelmann J, Lessig R, Willenberg A, Wildgrube R, Hering S, Szibor R (2006) Fore... |
Primer
| PrimerF: |
5' - |
TTGCAGAGGGATAGAAATGC |
- 3' |

| PrimerR: |
5' - |
TTGCAGAGGGATAGAAATGC |
- 3' |
 |
 |
| Comment: |
Primer DXS7127: PrimerF: 5'-ATTTCTTTCCCTCTGCAACC-3', PrimerR: 3'-CCAACGTCTCCCTTTCTTTA-5' |
Typical structure| 18-23 | - | Pr20-N36-[TATC]-N13-[TATC_TA]3-[TATC]-TG[TATC]-CA-[TATC]10-15-ATC-[TATC]-TCTC[TATC]-[TA]5-6-N28-Pr20 | | 23-27.2 (DXS7127) | - | Pr22-N71-[TA-TATC]4-5-TG-[TATC]1-CA-[TATC]10-11-[ATAC]2-C-[TCTA]2-[TA]4-5-N26-Pr20 |

| References: |
Edelmann J, Lessig R, Willenberg A, Wildgrube R, Hering S, Szibor R (2006) Fore...
|
| 9947A | 19.2/20 (DXS9908) | | 9947A | 24.2/25 (DXS7127) |

| References: |
Edelmann J, Lessig R, Willenberg A, Wildgrube R, Hering S, Szibor R (2006) Fore...
|
Population dataThe values of the evaluation parameters presented in the following table are calculated live utilizing the population data presented in the corresponding reference. For this reason it may happen that the numbers differ from the figures given in the reference. Click here to view the equations our calculations are based on.| 1 | Germany (DXS7127) | Edelman... | 0.7206 | 0.7544 | 0.5459 | 0.7206 | 0.7206 | 0.5857 | 0.9059 | 0.7544 | | 2 | Germany (DXS9908) | Edelman... | 0.7228 | 0.7571 | 0.5475 | 0.7226 | 0.7228 | 0.5882 | 0.9066 | 0.7571 |
| 1 |
Germany (DXS7127) |
Caucasian (European) |
Edelman... |
655 |
|
|
|
|
|
|
|
|
|
0.0122 |
0.2366 |
0.0458 |
0.3878 |
0.0718 |
0.1664 |
0.0153 |
0.0626 |
0.0015 |
| 2 |
Germany (DXS9908) |
Caucasian (European) |
Edelman... |
767 |
0.0078 |
0.2503 |
0.0443 |
0.3755 |
0.0717 |
0.1669 |
0.0169 |
0.0626 |
0.0026 |
0.0013 |
|
|
|
|
|
|
|
|
n* - If no information on the sex of the studied individuals is indicated, both sexes were examined.
ReferencesNo reference data.
|
 |

NewsLast updates:
• DXS9908 (DXS7127)• DXS6795• DXS6803• DXS10103• DXS8378
StatisticsPopulations: 44
Marker: 55
Allele frequencies: 2855 
|
 |